Skip to main content

Table 1 Primer sequences

From: The role of nicotinic receptors in SARS-CoV-2 receptor ACE2 expression in intestinal epithelia

Gene Forward sequence (5′ to 3′) Reverse sequence (5′ to 3′)
mEef2 TGTCAGTCATCGCCCATGTG CATCCTTGCGAGTGTCAGTGA
mNono AAAGCAGGCGAAGTTTTCATTC ATTTCCGCTAGGGTTCGTGTT
mGapdh ATGTGTCCGTCGTGGATCTGA ATGCCTGCTTCACCACCTTCT
mAce2 TCCAGACTCCGATCATCAAGC GCTCATGGTGTTCAGAATTGTGT
mVil1 CTCAAGACTCCGTCCTGCTG CCACTTGTTTCTCCGTCCGA
mCdh1 AACCCAAGCACGTATCAGGG GAGTGTTGGGGGCATCATCA
hACTB AATGTGGCCGAGGACTTTGA TGGCTTTTAGGATGGCAAGG
hPSMB6 ACCTGATGGCGGGAATCAT ATCATACCCCCCATAGGCACT
hRPLP0 TGTGGGAGCAGACAATGTGG TGAGGCAGCAGTTTCTCCAG
hACE2 CGAAGCCGAAGACCTGTTCTA GGGCAAGTGTGGACTGTTCC
hVIL1 CCAAAGGCCTGAGTGAAATC CCTGGAGCAGCTAGTGAACA
hCDH1 ATTTTTCCCTCGACACCCGAT TCCCAGGCGTAGACCAAGA